Journal: Molecular cell

Article Title: The Dystonia Gene THAP1 Controls DNA Double Strand Break Repair Choice

doi: 10.1016/j.molcel.2021.03.034

Figure Lengend Snippet: (A) Top: Venn diagram depicting differentially expressed genes (nascent RNA-seq, log2 fold-change >2 and FDR <0.05) in Thap1−/− versus WT and Thap1−/−Brca1Δ11 versus Brca1Δ11 MEFs in relation to THAP1-bound genes (ChIP-seq). The number of genes that were shown to be bound by THAP1 and were either downregulated or upregulated in THAP1-deficient MEFs are shown in blue and red, respectively.

Article Snippet: ChIP-seq was performed as described previously ( Shinoda et al., 2019 ) with a rabbit polyclonal antibody against THAP1 (Proteintech, 12584–1-AP).

Techniques: RNA Sequencing, ChIP-sequencing

Journal: Molecular cell

Article Title: The Dystonia Gene THAP1 Controls DNA Double Strand Break Repair Choice

doi: 10.1016/j.molcel.2021.03.034

Figure Lengend Snippet: (A) Western blot analysis of doxycycline-dependent expression of exogenous SHLD1 (left) and THAP1 (right) proteins in WT MEFs 24 to 96 hours after induction with doxycycline (Dox) as detected by anti-Flag antibody.

Article Snippet: ChIP-seq was performed as described previously ( Shinoda et al., 2019 ) with a rabbit polyclonal antibody against THAP1 (Proteintech, 12584–1-AP).

Techniques: Western Blot, Expressing

Journal: Molecular cell

Article Title: The Dystonia Gene THAP1 Controls DNA Double Strand Break Repair Choice

doi: 10.1016/j.molcel.2021.03.034

Figure Lengend Snippet: (A-B) Quantification of RPA2 (A) and RAD51 (B) foci in individual EdU-positive (S-phase) nuclei of WT, Brca1Δ11, Trp53bp1−/−Brca1Δ11 and two individual clones of Thap1−/− Brca1Δ11 MEFs. Cells were irradiated with 10 Gy and analyzed 4 h post-IR. Statistical significance was determined by Welch’s t-test.

Article Snippet: ChIP-seq was performed as described previously ( Shinoda et al., 2019 ) with a rabbit polyclonal antibody against THAP1 (Proteintech, 12584–1-AP).

Techniques: Clone Assay, Irradiation

Journal: Molecular cell

Article Title: The Dystonia Gene THAP1 Controls DNA Double Strand Break Repair Choice

doi: 10.1016/j.molcel.2021.03.034

Figure Lengend Snippet: (A) Representative flow cytometry plots of IgM-to-IgA class switch recombination (CSR) in WT, Trp53bp1−/−, Shld1−/−, Shld3−/− and two individual clones of Thap1−/− (#4 and #12) CH12-F3 cells 24 hours after cytokine stimulation (IL-4, CD40L and TGFβ). Unstimulated WT cells are shown as a negative control. Quantification of IgM-to-IgA CSR is shown on the right and represents mean ± s.d., n=3.

Article Snippet: ChIP-seq was performed as described previously ( Shinoda et al., 2019 ) with a rabbit polyclonal antibody against THAP1 (Proteintech, 12584–1-AP).

Techniques: Flow Cytometry, Clone Assay, Negative Control

Journal: Molecular cell

Article Title: The Dystonia Gene THAP1 Controls DNA Double Strand Break Repair Choice

doi: 10.1016/j.molcel.2021.03.034

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ChIP-seq was performed as described previously ( Shinoda et al., 2019 ) with a rabbit polyclonal antibody against THAP1 (Proteintech, 12584–1-AP).

Techniques: Purification, Blocking Assay, Virus, Bacteria, Expressing, CRISPR, Knock-Out, Recombinant, Transfection, Cloning, PCR Cloning, Protease Inhibitor, Ligation, Library Quantification, Selection, Flow Cytometry, Cell Viability Assay, cDNA Synthesis, SYBR Green Assay, Cell Culture, Mutagenesis, Illumina Sequencing, Software, Microscopy, Imaging, Irradiation

Journal: Journal of Molecular Neuroscience

Article Title: Unraveling Molecular Mechanisms of THAP1 Missense Mutations in DYT6 Dystonia

doi: 10.1007/s12031-020-01490-2

Figure Lengend Snippet: THAP1 molecular weight and subcellular distribution of THAP1. a Western blot showing a 30-kDa band and a 25-kDa band in HEK cells overexpressing wild-type THAP1 or F21L mutant THAP1 using the Proteintech antibody (12584-1-AP). A small band (around 27 kDa) was observed in HEK cells overexpressing Q154fs180X mutant THAP1. Mass spectrometry analysis detected two THAP1 peptides in the 30-kDa band (peptide 1, IHQLEQQVEK; peptide 2, LKEVVHFQK) but not in the 25-kDa band. b Wild-type and missense mutant (F81L and L180S) THAP1 protein distributed mainly in the nuclear fraction. Lamin A/C was used as marker of nuclear protein

Article Snippet: Fig. 1 THAP1 molecular weight and subcellular distribution of THAP1. a Western blot showing a 30-kDa band and a 25-kDa band in HEK cells overexpressing wild-type THAP1 or F21L mutant THAP1 using the Proteintech antibody (12584-1-AP).

Techniques: Molecular Weight, Western Blot, Mutagenesis, Mass Spectrometry, Marker

Journal: Nucleic Acids Research

Article Title: Stress-induced changes in gene interactions in human cells

doi: 10.1093/nar/gkt999

Figure Lengend Snippet: THAP1 and RAB35, two ER stress-responsive genes and PSMC3IP, an IR stress-responsive gene identified in this study. ( A ) THAP1 protein levels are increased in response to ER stress induced by tunicamycin in primary human fibroblasts; results of biological triplicates. The ratio of THAP1 to glyceraldehyde 3-phosphate dehydrogenase is reported below each lane. ( B ) Knockdown of THAP1 (average knockdown of 49%) ( P = 0.03) resulted in attenuated induction of ATF4 and DDIT3 /CHOP ( P < 0.005) but not HSPA5 /BIP ( P = 0.75). ( C ) Knockdown of RAB35 (average knockdown 63%) ( P = 0.005) resulted in increased induction of ATF4 ( P = 0.04) and DDIT3 /CHOP ( P = 0.05). ( D ) Induction of PSMC3IP is associated with IR-induced cell death in B-cells ( n = 10). Error bars represent S.E.M.

Article Snippet: Protein levels of THAP1 were assessed using rabbit antibody directed against Thap1 (ProteinTech, IL, USA) and normalized to glyceraldehyde 3-phosphate dehydrogenase (sc-137179, Santa Cruz Biotechnology, CA, USA).

Techniques:

Journal: Acta Neuropathologica Communications

Article Title: Dystonia type 6 gene product Thap1: identification of a 50 kDa DNA-binding species in neuronal nuclear fractions

doi: 10.1186/s40478-014-0139-1

Figure Lengend Snippet: Primary striatal neurons contain endogenous 32 and 50 kDa T1-LIR species in the nuclear compartment, and the 32 kDa species increases following transduction with Ad-hThap1. (a) Total cellular extract (50 μg) from untreated (control) mouse striatal neurons blotted with the Proteintech antibody reveals endogenous 29, 50 and 75 kDa T1-LIR species. Following transduction with Ad-hThap1, a transduction-dependent 47 kDa species is detected (**), the 50 kDa species increases slightly in intensity (arrow) and a prominent 32 kDa species (*) appears, as detected by the Proteintech and NeuroMab antibodies. (b) An aliquot (40 μg) of protein from the cytoplasmic compartment from adult mouse brain and untreated and Ad-hThap1-transduced primary striatal neurons was separated and immunoblotted as indicated. The 29 kDa T1-LIR species was prominent in all 3 samples, whereas the 50 kDa (arrow) was detected only in primary striatal neuronal extract. T1-LIR species of greater apparent M r were present in all 3 samples. (c) The 29 (*), 50 doublet (brackets) and 75 kDa (arrow) T1-LIR species were detected in 10 μg of adult brain nuclear extract, whereas, in primary striatal neuronal extract, a 32 kDa T1-LIR (**) was detected and the upper band of the 50 kDa T1-LIR species was relatively more prominent (brackets). Note that the NeuroMab and Santa Cruz antibodies do not detect all the identical species, but all recognize the 32 kDa species (**), which was observed to increase following transduction with Ad-hThap. The transduction-dependent 47 kDa species is recognized only by Proteintech (empty arrow). SC3H3 and NeuroMab antibodies also recognize a 27 kDa T1-LIR species in adult brain (filled arrowhead) and a very prominent 50+ kDa species (empty arrowhead).

Article Snippet: The endogenous TL1-LIR ~32 kDa species was highly enriched by IP of mouse newborn brain nuclear extract using either the Proteintech anti-Thap1 or the Santa Cruz anti-Thap1 followed by immunoblotting with Proteintech anti-Thap1 (Figure b), but the ~50 kDa T1-LIR was barely detectable.

Techniques: Transduction, Control

Journal: Acta Neuropathologica Communications

Article Title: Dystonia type 6 gene product Thap1: identification of a 50 kDa DNA-binding species in neuronal nuclear fractions

doi: 10.1186/s40478-014-0139-1

Figure Lengend Snippet: A 50 kDa T1-LIR species is detected by Proteintech antibody in mouse neural tissue and testes and is developmentally regulated. (a) Nuclear (150 μg) and cytoplasmic (150 μg) extracts from adult heart, testis, and whole brain were subjected to SDS-PAGE and immunoblotted with Proteintech anti-Thap1 antibody. The 29 kDa T1-LIR species (*) was detected in both compartments in all three tissues. The 32 kDa species (**) was detected only in nuclear extract from testis. The 50 kDa species (arrow) was detected in the nuclear compartment in testis (doublet) and brain, with a trace amount detected in cytoplasm, likely due to contamination with nuclear proteins (not shown). (b) Total cellular extracts (50 μg) from adult peripheral organs (left panel) and adult and E15 individual brain regions (right panel) were immunoblotted with Proteintech anti-Thap1 antibody. “Positive control lysate” lane corresponds to HEK293T cells transfected with a human Thap1 expression vector. (c) Extracts from liver, cerebellum and forebrain from P1 mice were subjected to SDS-PAGE, immunoblotted, and patterns were compared to those observed in adult cerebellum. Total cellular RIPA (150–200 μg), cytoplasmic (cyt) (150–200 μg) and nuclear (nuc) extracts (50–75 μg) were immunoblotted with Proteintech antibody. The lower 50 kDa T1-LIR species (**) was detected only in brain tissues and the levels of the upper 50 kDa (arrow) and lower 50 kDa were increased in P1 relative to adult. Note that the 50+ kDa species in P1 liver nucleus does not co-migrate with either of the two brain species. The 29 kDa species (*) appeared in nuclear extract only in neural tissue.

Article Snippet: The endogenous TL1-LIR ~32 kDa species was highly enriched by IP of mouse newborn brain nuclear extract using either the Proteintech anti-Thap1 or the Santa Cruz anti-Thap1 followed by immunoblotting with Proteintech anti-Thap1 (Figure b), but the ~50 kDa T1-LIR was barely detectable.

Techniques: SDS Page, Positive Control, Transfection, Expressing, Plasmid Preparation

Journal: Acta Neuropathologica Communications

Article Title: Dystonia type 6 gene product Thap1: identification of a 50 kDa DNA-binding species in neuronal nuclear fractions

doi: 10.1186/s40478-014-0139-1

Figure Lengend Snippet: Silencing of Thap1 in mouse primary striatal neurons leads to a decrease in the levels of the 32 kDa and 50 kDa T1-LIR species. (a) Quantitative real-time PCR assay of mTHAP1 was performed on cDNA derived from mRNA from untreated mouse primary striatal neurons and following transduction with lentiviral (LV) particles expressing mThap1, shThap21 or 96, or shLuc control sequences (left panel) (representative of 2 independent experiments) or AAV particles expressing a third shRNA sequence directed at mThap1 (N = 3) (Unpaired t-test : *p < 0.05; Untreated level arbitrarily set at 100%). (b) Left panel: Westem blotting of total cellular extract, 40 μg, from primary striatal neurons transduced with either LV-mThap1 or LV-GFP control alone or together with lentivirus carrying shRNA #96 sequence directed at mThap1 or non-silencing (NS) shRNA. Right panel: Identical experiment as in left panel except for replacement of LV with AAV with a different shRNA sequence, as in (a) . MOI for LV = 2.5 viral particles/neuron; for AAV = 100,000 viral particles/neuron. (c) Graphs show densitometry of blots from experiments represented in (b) . (N = 4 for LV-4, shRNA, N = 2 for AAV-shRNA). (NI = non-infected) (d) Transduction of primary striatal neurons with LV-mThap1 increases the intensity of the 32 (*) and upper 50 kDa (arrowhead) T1-LIR species in nuclear extracts (10 μg), and the relative increase is decreased by co-transduction with AAV-shRNA specific to Thap1 in the nucleus of primary striatum cultures.

Article Snippet: The endogenous TL1-LIR ~32 kDa species was highly enriched by IP of mouse newborn brain nuclear extract using either the Proteintech anti-Thap1 or the Santa Cruz anti-Thap1 followed by immunoblotting with Proteintech anti-Thap1 (Figure b), but the ~50 kDa T1-LIR was barely detectable.

Techniques: Real-time Polymerase Chain Reaction, Derivative Assay, Transduction, Expressing, Control, shRNA, Sequencing, Infection

Journal: Acta Neuropathologica Communications

Article Title: Dystonia type 6 gene product Thap1: identification of a 50 kDa DNA-binding species in neuronal nuclear fractions

doi: 10.1186/s40478-014-0139-1

Figure Lengend Snippet: The T1-LIR 32 kDa and 50 kDa species are enriched by immunoprecipitation (IP) in transduced HEK293T and wild type newborn brain nuclear extract. (a) Total cellular extracts from HEK293T cells transduced with Ad-V5/Thap1-GFP were subjected to immunoprecipitation using anti-V5 antibody, separated by PAGE, and transferred to nitrocellulose. The membrane was incubated with Proteintech anti-Thap1 and anti-V5 antibody. On the right panel, Ponceau S staining of the membrane shows relative protein loading in each lane. Control = untreated cells. (b) Nuclear and cytoplasmic extracts from P1 forebrain were subjected to immunoprecipitation using Proteintech antibody or the SC3H3 antibody. The T1-LIR species of 32 kDa (*) and a very small amount of the 50 kDa species (arrow) can be detected in the elution with the Proteintech (PT) antibody. IP with Santa Cruz 3H3 (SC) (last lane) confirms the enrichment of the 32 kDa species. (c) A protocol similar to that employed in (b) was used except that the P1 forebrain extract was treated with calf intestinal phosphatase (CIP) prior to IP. IP was perfomed using Proteintech (PT) or Santa Cruz (SC) antibodies. Note that the 32 kDa T1-LIR species is obscured by the light chain in the eluate, but the 50 kDa T1-LIR species (arrow) is more easily identified in nuclear samples treated with CIP (compare to 8b).

Article Snippet: The endogenous TL1-LIR ~32 kDa species was highly enriched by IP of mouse newborn brain nuclear extract using either the Proteintech anti-Thap1 or the Santa Cruz anti-Thap1 followed by immunoblotting with Proteintech anti-Thap1 (Figure b), but the ~50 kDa T1-LIR was barely detectable.

Techniques: Immunoprecipitation, Transduction, Membrane, Incubation, Staining, Control

Journal: Acta Neuropathologica Communications

Article Title: Dystonia type 6 gene product Thap1: identification of a 50 kDa DNA-binding species in neuronal nuclear fractions

doi: 10.1186/s40478-014-0139-1

Figure Lengend Snippet: The T1-LIR 32 kDa (transduced HEK293T and P1 brain) and 50 kDa (P1 brain) species are enriched by oligonucleotide DNA affinity chromatography. (a) Total cellular extracts from HEK293T cells transduced with Ad-mThap1 were subjected to DNA affinity chromatography using a THABS oligonucleotide polymer. The 32 kDa T1-LIR species (arrow) was enriched in the eluate relative to input. (b) P1 forebrain nuclear (nuc) extract was subjected to DNA affinity chromatography using a THABS DNA oligonucleotide column. The endogenous 32 kDa (*) and 50 kDa doublet (** and arrow) T1-LIR species were enriched in the eluate relative to input. Bottom panels are the membranes stained with Ponceau S.

Article Snippet: The endogenous TL1-LIR ~32 kDa species was highly enriched by IP of mouse newborn brain nuclear extract using either the Proteintech anti-Thap1 or the Santa Cruz anti-Thap1 followed by immunoblotting with Proteintech anti-Thap1 (Figure b), but the ~50 kDa T1-LIR was barely detectable.

Techniques: Affinity Chromatography, Transduction, Polymer, Staining

Journal: Acta Neuropathologica Communications

Article Title: Dystonia type 6 gene product Thap1: identification of a 50 kDa DNA-binding species in neuronal nuclear fractions

doi: 10.1186/s40478-014-0139-1

Figure Lengend Snippet: Distribution of T1-LIR species in HEK293T cells, primary striatal neuronal cultures and murine peripheral and nervous tissues

Article Snippet: Gavarini et al. (2010) [ ] described a T1-LIR species in wild type (WT) mouse brain at ~30 kDa when a commercial rabbit polyclonal anti-Thap1 (Proteintech) was used for immunoblotting.

Techniques:

Journal: Developmental cell

Article Title: The DYT6 Dystonia Protein THAP1 Regulates Myelination Within The Oligodendrocyte Lineage

doi: 10.1016/j.devcel.2017.06.009

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Age and sex-matched littermate mice were used for all experiments. table ft1 table-wrap mode="anchored" t5 REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat anti-THAP1 Santacruz Cat# sc-98174 Rabbit anti-THAP1 Proteintech Cat# 12584-1-AP Rabbit anti-YY1 Santacruz Cat# sc-281 Mouse anti-YY1 Santacruz Cat# sc-7341 Normalized anti-Rabbit IgG Santacruz Cat# sc-2027 Rat anti-MBP Millipore Cat# MAB386 Mouse anti-Actin Sigma Cat# A53166 Rabbit anti-MOBP One World Lab Cat# AP6913a Mouse anti-MOG Millipore Cat# MAB5680 Mouse anti-CNP Sigma Cat# C5922 Mouse anti-β III - TUBULIN Millipore Cat# MAB1637 Rabbit anti-PLP1 This Study Provided by Dr. Roman Giger, University of Michigan Rabbit anti-MAG This Study Provided by Dr. Roman Giger, University of Michigan Mouse anti-MAG Millipore Cat# MAB1567 HRP conjugated Donkey Anti-Rabbit Pierce Cat# 31402 HRP conjugated Donkey Anti-Mouse Jackson Immunoresearch Cat# 115-035-003 Bacterial and Virus Strains N/A Biological Samples N/A Chemicals, Peptides, and Recombinant Proteins Murine FGF2 Peprotech Cat# 450-33 Murine EGF Peprotech Cat# AF-100-15 Murine PDGF-AA Peprotech Cat# 315-17 RAT CNTF Peprotech Cat# 450-50 Human NT3 Peprotech Cat# 450-03 2x SYBR Green qPCR Master Mix Bimake Cat# B21202 Dynabeads ProteinG Thermofisher Cat# 10003D Purmorphamine Cayman Chemical Cat# 483367-10-8 Neurobasal Thermofisher Cat# 21103049 DMEM/F12 Thermofisher Cat# 11320-033 DMEM High Glucose Thermofisher Cat# 11995040 Critical Commercial Assays VECTASTAIN ELITE ABC Kit Vector Laboratories Cat# PK-6100 SMART MMLV Reverse Transcriptase Clontech Cat# 639522 Quick-RNA MicroPrep Zymo Research Cat# R1050 Deposited Data Microarray This Study GSE97372 Chip-Seq THAP1 ENCODE GSM803408 Chip-Seq YY1 ENCODE GSM803446 Experimental Models: Cell Lines Neural Stem Cells - NSC This Study N/A Oligodendrocyte Progenitor Cells - OPC This Study N/A HEK-293 ATCC CRL-1573 Experimental Models: Organisms/Strains N/A Oligonucleotides lox-F This Study TGCTGGGTGTTGGAAAATAA frt-F This Study GCATAGGACAGAGCCTTTCAG frt-R This Study GATGCCAATACCTGATTGGAG QRT - PCR This Study Table S6 qCHIP - PCR This Study Table S6 Recombinant DNA pSPORT-YY1 GE Dharmacon MMM1013-202761238 pDEST26 – FLAG-THAP1 This Study N/A pDEST26 – THAP1 This Study N/A Software and Algorithms Image J NIH https://imagej.nih.gov/ij/ Graphed Prism GraphPad https://graphpad.com/scientific-software/prism/ Other N/A Open in a separate window KEY RESOURCES TABLE

Techniques: Recombinant, SYBR Green Assay, Plasmid Preparation, Microarray, Quantitative RT-PCR, Software